Studies on Biosurfactant producing bacteria from Jeppiaar salt pan with special reference to anticancer activity

S. Sudha Sri Kesavan^1*, Moyuri Handique², Kumar Chandrasekaran³, R. Athanasius Jeromin Jeevitha², M. Alagunachiyar², J. Monica Amala Nayaki²

¹Assistant Professor, Department of Biotechnology, Sathyabama University, Chennai-119.

²B.Tech Students, Department of Biotechnology, Sathyabama University, Chennai-119

³Scientist B, Ocean Research Center, Sathyabama University, Chennai.

*Corresponding Author E-mail: sudhakesavan@yahoo.com

Received on 16.03.2016 Modified on 04.04.2016

Research J. Pharm. and Tech. 9(4): April, 2016; Page 348-354

DOI: 10.5958/0974-360X.2016.00062.7

ABSTRACT:

Biosurfactants are surface-active compounds produced by microorganisms. These molecules reduce surface tension between aqueous solutions and hydrocarbon mixtures. In this study, we collected water samples from Jeppiaar salt pan in Chennai, Tamilnadu, India. Ten different microorganisms were isolated from salt pan water samples. Screening of biosurfactants producing potential strain was done using Hemolytic activity, Oil displacement test, Drop Collapse assay. Four isolates were positive for biosuractant production among that one isolate was found as potential biosurfactant producer. Both biochemical and 16S rRNA sequencing methods one of the potential strain was identified as Bacillus cereus JS06. The biosurfactant was extracted from cell-free broth at 72-h grown cells by step-by-step purification of acid precipitation method. The dried surfactant was used for further characterization by Fourier transmission Infrared spectroscopy with attenuated total reflectance (FTIR-ATR) and anticancer studies. On FTIR-ATR analysis characteristic absorbance bands were observed for the extracted biosurfactant. The crude biosurfactant was screened for its anticancer activity against human laryngeal carcinoma (HEP-2) cell line and transformed aneuploid immortal keratinocyte (HeCAT) cell line. The results obtained showed that biosurfactants have better interfacial-activity and anticancer property, thus being more attractive to be applied in pharmaceuticals and medical field.

KEYWORDS: Biosurfactant, hemolytic activity, oil displacement test, drop collapse assay, human laryngeal cell line, immortal keratinocyte cell line.

INTRODUCTION:

Biosurfactants are molecules with diverse group of surface active chemical components produced by number of microorganisms and that can be used in many biomedical applications^1-3. Comprising a range of chemical structures, such as glycolipids, glycoproteins and lipopeptides, among others⁴, different biosurfactants is expected to exhibit diverse properties and physiological functions⁵. Several researchers showed that biosurfactants partition at interfaces affecting the adhesion properties of microorganisms ^6,7.

Additionally, these molecules are able to increase membrane permeability by disrupting and lysing cell membranes^8,9.

Relevant properties of biosurfactants including their antimicrobial and antiviral activities, as well as their anti-adhesive activity against pathogens^{10, 11, 12} make them interesting alternatives for biomedical applications. Such molecules may be useful for gene transfection, as ligands for binding immunoglobulins, as adjuvants for antigens, as inhibitors of fibrin clot formation, as activators of fibrin clot lysis, but also a s anti adhesive biological coatings for prosthetic materials.

The most commonly isolated biosurfactants are glycolipids containing the sugars rhamanose or trehalose. Bacterial glycolipid producing organisms include Pseudomonas aeroginosa (mono and di-rhamnolipids), cornybacterium, Nocardia and Rhodococus spp (rehalose dimycolates/ dicornynomycolates, trehalose tetraesters, etc). The structural diversity of the biosurfactants along with their advantages of low toxicity and biodegrability makes them a viable alternative to the common chemically synthesized surfactants and determines their specialized applications¹³.

Microbially-derived surfactants are amphipathic molecules produced by a wide variety of bacteria, yeasts and filamentous fungi. Biosurfactants have properties of the general surfactants, which reduce the interfacial tensions between liquids, solids and gases and confer excellent detergency, emulsifying, foaming and other versatile chemical process. Compared with chemical surfactant, biosurfactants offer several advantages, such as low toxicity, inherently good biodegradability, and ecological acceptability¹⁴.

In recent years, natural surfactants of microbial origin, known as biosurfactants, are getting much more attention compared with the chemical surfactants owing to their lower toxicity, biodegradability, low anti-irritating effects and compatibility with skin¹⁵.

The lipopeptide biosurfactant are most prominently known as surfactin produced mostly by the Bacillus sp. Despite similar global structures, surfactins, iturins and fengycins differ in some aspects regarding their biological activities¹⁶. The search for novel biosurfactants in extremophiles seems to be particularly promising since they have particular adaptations to increase stability in adverse environments and the microbial products are highly stable and important in medical biotechnology. The present study pointed out the screening, characterization and its anticancer activity of biosurfactants extracted from the halophilic bacteria which was isolated from Jeppiaar salt pan works in southern India, Chennai.

MATERIALS AND METHODS:

Sample collection:

Condenser water having a salinity of 155% was collected from the solar salt in Jeppiaar salt pan, Chennai, Tamilnadu, India. Samples were collected in sterile polythene bags, transported to the laboratory aseptically and stored at 4ºC for further use.

Isolation and purification of bacteria:

Water samples were serially diluted 10^-1 to 10^-6in sterile distilled water and 100ml of each dilution was spread onto sterile nutrient agar plates containing 5% NaCl (Composition of Nutrient Agar: 0.5% peptone, 0.3% beef extract/ Yeast extract, 0.5% NaCl, pH of the medium was adjusted to 6.8 at 25 ºC. The plates were incubated at 37 ºC for 24h, after the incubation period morphologically different colonies selected and purified in nutrient agar and preserved in nutrient agar slants for further use.

Screening of biosurfactant producing micro organisms

Hemolytic activity

Hemolytic assay was performed in 5% sheep blood agar plates. 50µl of bacterial culture grown in nutrient agar medium was spot inoculated on to blood agar plates and incubated for 48 h at 37^o C. The plates were visually inspected for clear zone (hemolysis) around the colony. The diameter of the clear zone is a qualitative method used as an indicator of biosurfactant production.

Cell free culture broth preparation

All the hemolytic positive isolates were grown aerobically in 100 ml Erlenmeyer flask with 50 ml of mineral salt medium containing (g l-1 ) 1.0 K₂ HPO₄, 0.2 MgSO₄.7H₂ O, 0.05 FeSO₄.7H₂ O, 0.1 CaCl₂.2H₂ O, 0.001 Na₂ MoO₄.2H₂ O, 30 NaCl and crude oil (1.0%, w/v). Vegetable oil used in this study was obtained from Super Market, Chennai. Flasks containing sterilized mineral salt medium were inoculated with a loopful of bacterial culture from nutrient agar plates and the culture flasks were maintained in a shaker for 7 days at 200 rpm and 30^oC. After 3 days of incubation, culture broth from each flask was centrifuged at 6000 rpm and 4^oC for 15 minutes and the supernatant was filtered through 0.45µm pore size filter paper (Millipore). This cell free culture broth was used for oil displacement assay, emulsification assay, drop collapse assay all the screening experiments were performed in triplicates.

Oil displacement test:

The oil displacement test is a method used to determine the surface activity by measuring the displacement of oil. The broth culture of selected isolate was centrifuged at 10000 rpm for 20 minutes. 50ml of distilled water was added to the Petridis followed by the 100µl of cell free culture broth was dropped on to the surface of the vegetable oil. The diameter of clear zone on the oil surface was measured and compared with 10µl of distilled water as negative control ¹⁷.

Drop Collapse Assay:

This assay relies on the destabilization of liquid droplets by surfactants. Drops of a cell suspension (culture supernatant selected strain) was placed on an oil coated, solid surface. If the liquid does not contain surfactants, the polar water molecules were repelled from the hydrophobic surface and the drops remain stable. If the liquid contains surfactants, the drops spread or even collapse because the force or interfacial tension between the liquid drop and the hydrophobic surface was reduced. The stability of drops is dependent on surfactant concentration and correlates with surface and interfacial tension. JS10 strain tested gave positive results for drop collapse test.

Extraction of biosurfactants:

The surface-active molecule from the selected isolate was obtained chemically by acidification of the cell free broth¹⁸ . Briefly, after about 28 h of growth the culture broth was centrifuged at 10000 g for 20 min in a tabletop centrifuge (Eppendorf, Hamburg, Germany) to pellet the cells. Concentrated HCl was added to the cell free supernatant until it attained a pH value of 2. The acidified cell free culture broth was then stored at 4ºC overnight for precipitation of surface-active compounds. The precipitate was centrifuged at 10000 g for 20 min to get the crude biosurfactant as pellet. The biosurfactant pellet was re-suspended in water and the pH was raised to 7.5 to solubilize biosurfactants.

Chemical characterization of biosurfactant by FTIR:

The basic functional group of the crude biosurfactant from halophilic isolate was analysed qualitatively by Fourier Transform Infra Red (FTIR)¹⁹. The solid biosurfactant extracts recovered from the supernatants of the selected isolates were characterized by Fourier transform infrared spectroscopy (FTIR). The FTIR spectra, with a resolution of 4 cm^-1 , were collected from 400 to 4000 wavenumbers (cm1), and is an average of 128 scans using a Tensor 27 Infrared Spectrometer operating in the attenuated total reflection (ATR) mode (equipped with a single horizontal Golden Gate ATR cell).

Cytotoxicity assay

The anticancer activity of crude biosurfactant was tested against one cancer cell lines HEP-2, and cytotoxicity was tested against one normal cell line HeCAT by MTT assay following the procedure of ²⁰.

The human laryngeal cancer cell line HEP-2 and human keratinocyte line HeCAT a normal cell line were obtained from Veterinary College, Chennai, India. Cells were grown as monolayer culture in MEM medium and incubated at 37°C in a 5% of CO₂ atmosphere. For the preliminary screening HEP-2 and HeCAT cells (100μl) were seeded in 96 well plates at a concentration of 5X10³ cells/ml for 24 hrs. After the incubation the culture medium was replaced with 100ml serum free medium containing various concentrations (3.87, 7.75, 15.5, 31.25, 62.5, 125, 250, 500, 1000 and 2000µg/ml) of Bio surfactant crude extracts for 24 hrs. After that, the medium was refreshed with 100μl of serum free medium (MEM) and 20μl of MTT (5mg/ml of (3,4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazoliumbromide) was added. The micro-titer plates were incubated for three hours in dark. After incubation the treatment was stopped with 180μl of DMSO. Triplicates were maintained for each treatment. The developed colour was measured with ELISA reader at 570 nm. The IC₅₀ was determined by Linear regression analysis using Microsoft office excel work sheet. By plotting a graph of Log (concentration of compound) vs % cell inhibition, the concentration of compound required to inhibit 50 % cell growth (IC₅₀) was determined. A line drawn from 50 % value on the Y axis meets the curve and interpolate to the X axis. The X axis value gives the Log (concentration of compound). The antilog of that value gives the IC₅₀ value²¹.

% of viability = Mean Test OD_x 100

Mean OD of Control

% cell inhibition = 100 − % cell survival

Genomic identification by 16S rRNA sequencing

Genomic DNA (100 ng) isolated from the selected halophilic isolate was amplified by PCR using 16S rRNA universal primers (Forward: 5’ CAGGCCTAACACATGCAAGTC 3’; Reverse: 5’ GGGCGGWGTGTACAAGGC 3’). The PCR product was cloned into the vector pTZ57R and used to transform Escherichia coli DH5 as described by²². The transformants were sequenced using an ABI 3700 automated DNA sequencer. Sequences were compared with other 16S rRNAs obtained from GenBank using the BLAST program. The phylogenetic tree was constructed by MEGA5 software and evolutionary evolutionary distances were computed using the Maximum Composite Likelihood method²³.

RESULTS AND DISCUSSION:

Isolation of bacteria

Based on the size and color of the colonies on agar plates ten different colonies were isolated from the salt pan water sample by serial dilution method. The colony morphology of the ten isolates such as white, cream white, light yellow, yellow, pale orange, orange, red, light red, light green. The isolates were purified and preserved on Nutrient agar slants with 5% of NaCl for further usage. The isolates were labeled as JS01, JS02, JS03, JS04, JS05, JS06, JS07, JS08, JS10 respectively (Figure: 1, 2 shows the isolation plates showing different bacterial isolate).

In a similar study three different colonies were isolated from agar plates based on the color such as pink, creamy and creamy white from the salt pan water collected from the solar salt works in Thamaraikulam, Kanyakumari district, Tamilnadu, India²⁴.

Screening of biosurfactant producing micro organisms

Hemolytic activity

Blood agar hemolysis test was made use of by many researchers to check for biosurfactant secretion^25,26. In the present study, all the ten isolates were checked for hemolytic activity among that one of the isolate (JS06) showed excellent hemolytic activity on the blood agar plate and three others (JS-01 and J02 and JS08) showed medium activity (Figure:3). Though this test is a primary screening technique, all biosurfactants do not have hemolytic activity and hence, all the other tests were performed to predict biosurfactant production.

Figure: 3. Bacillus sp. JS06. grown on blood agar, Zone of clearance around the colonies indicate production of Biosurfactant

Oil spreading assay

In the oil spreading technique, the quantities of biosurfactant secreted by the isolates were determined by the extent of oil displacement²⁷. The isolates (JS06) displaced the oil layer significantly, whereas JS01, JS-02 and JS-08 moderately displaced (Figure: 4). The oil layer remained unchanged with the rest of the cultures, without showing a zone of displacement (Table:1).

Figure:4 Zone of displacement on Oil spreading assay For isolate JS10

Table 1 Clear zone in diameter (cm) by Oil spreading assay

ISOLATES	Diameter in( cm)	Interpretation
JS01	2	Positive
JS02	1.4	Positive
JS03	0	Negative
JS04	0	Negative
JS05	0	Negative
JS06	0	Negative
JS07	0	Negative
JS08	3	Positive
JS09	0	Negative
JS10	6	Positive (good)

Drop Collapse Assay

Drop collapse method is a sensitive and easy to perform method which requires small volume (~5µl) of culture broth or biosurfactant solution to test the surfactant property. Among the 10 isolates screened, isolate JS06, JS01, JS02 andJS08 were positive for drop collapse activity. The remaining isolates were negative for drop collapse activity.

The stability of drops is dependent on surfactant concentration and correlates with surface and interfacial tension. JS06 strain tested gave positive results for drop collapse test. The positive strain was mass cultured in Nutrient Agar for extraction of Biosurfactants.

Extraction of biosurfactants

The biosurfactant was extracted from cell-free broth at 72-h grown cells by step-by-step purification of acid precipitation method. The dried surfactant was extracted with acetone and dried with the aid of a rotary evaporator under vacuum and was used for further characterization and anticancer studies.

Chemical characterization of biosurfactant

Fourier transmission Infrared spectroscopy (FTIR)

Firstly, fast and direct characterizations of the biosurfactants produced by JS06 isolates, it was performed using a FTIR-ATR analysis (Figure: 5, a,b,c and d). It can be clearly observed characteristic absorbance bands of carbon containing compounds with amino groups at 3200 cm1 (C-H-stretching mode); Sharp absorbance peaks are observed at 1250 cm-1, 1600 cm-1 are indicative of aliphatic chains (-CH3 and -CH2-). These peaks reflect the presence of alkyl chains in the compound.

A strong band was also observed at 2000 cm-1, 2100 cm-1, 2500 cm-1 indicate the presence of the carbonyl group. The FTIR spectrum implied the production of a lipopeptide biosurfactant. This FTIR-ATR analysis indicates the presence of aliphatic hydrocarbons combined with a peptide moiety that is characteristic of lipopeptide biosurfactants, as it has been previously described in the literature^28,29.

Figure: 5 a TRANS-BSCR-SM (Transmission-base line correction-smoothning)

Figure 5b: ABS-BSCR-SM-ARTCR (Absorption - baseline correction - smoothning - attenuated reflection and transmission correction method)

Figure 5c: BSCR- SM-ARTCR (Transmission – base line correction – smoothning - attenuated reflection and transmission correction method)

Figure 5d: REF-BSCR-SM-ARTCR (Reflection – base line correction – smoothning - attenuated reflection and transmission correction method)

Anticancer and cytotoxicity activity:

The crude extracts of Biosurfactant was used to screen the anticancer and cytotoxic property against HEP-2 and HeCAT cell lines. Cytotoxic activity was assessed by MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide) method. The Biosurfactant crude extracts from isolate JS06 was used to find activity against Human laryngeal carcinoma cell lines (HEP-2) and cytotoxicity against a normal cell lines human keratinocyte line (HeCAT).

On HEP-2 cell lines, IC₅₀ values of the biosurfactant crude extract was 446.6 µg/ml and IC₅₀ values on HeCAT was 177.8 µg/ml. The inhibitory activity of biosurfactant on cancer cell line was less than 500 µg/ml against the tested two cancer cell lines; it shows it should possess the anticancer properties. Since it was a preliminary screening for anticancer activity, the inhibition of cancer cell growth only studied now, to determine the anticancer efficacy the purified biosurfactant will be used in further studies. Figure:6

In a similar study biosurfactant from the salt pan bacteria have been implicated in growth arrest, apoptosis and the differentiation of mouse malignant melanoma cells. The biosurfactant also have some anticancer activities, they suppress the cell viability in tumor mammary epithelial carcinoma cells at 25% in the 25 μg concentrations³⁰.

Figure: 6 IC50 For the crude Biosurfactants against HeCAT and HEP-2 cell lines

16S rRNA Sequencing of the selected isolate

The partial 16S rRNA sequence of the isolate JS06 was aligned manually with available (16S rRNA) sequences retrieved from Gen bank using cluster X version (Figure:7). Comparison of the 16S rRNA nucleotide gene sequence of isolate JS06 corresponding with bacterial sequences clearly shows that the organism is closely related to Bacillus cereus.

SUMMARY AND CONCLUSION:

Ten bacterial isolates were isolated from Jeppiaar salt pan, Chennai. They are JS01, JS02, JS03, JS04, JS05, JS06, JS07, JS08, JS10 respectively. Among the ten strains JS06 was selected for their potential activity of biosurfactant production. 16s rRNA sequencing results confirmed that the potent strain JS06 was Bacillus cereus. Screening results such as Blood agar lysis method, Oil displacement technique, Drop collapse method confirmed the production of biosurfactant (JS06). FTIR analysis indicates the presence of aliphatic hydrocarbons combined with a peptide moiety that is characteristic of lipopeptide biosurfactants. In preliminary anticancer screening assays, the biosurfactant crude extract of selected isolate JS06 was tested against HEP-2 and HeCAT cell lines. The biosurfactant crude extract showed maximum cytotoxicity with the less IC₅₀of 446.6 μg/ml on HEP-2 cell lines and (177.6μg/ml) against HeCAT cell lines. The crude biosurfactant shows maximum anticancer activity and minimum cytotoxicity on normal cell lines. So further studies are needed to produce to use this biosurfactant as a anticancer drug with less cytotoxicity.

ACKNOWLEDGEMENTS:

The authors are grateful to the Management of Sathyabama University. We also thank The Department of Biotechnology, Sathyabama University for providing facilities required to carry out our research work.

REFERENCES:

1. Gudiña EJ, Rangarajan R, Sen R and Rodrigues LR. Potential therapeutic applications of biosurfactants. Trends Pharmacol Sci. 4; 2013: 667–675.

2. Rodrigues LR, Banat IM, Teixeira JA and Oliveira R. Biosurfactants: potential applications in medicine. J Antimicrobiology Chemotheraphy. 57; 2006ª: pp. 609–618.

3. Rodrigues LR, Van der Mei HC, Teixeira JA and Oliveira R. Biosurfactant from Lactococcus lactis 53 inhibit microbial adhesion on silicone rubber. Appl Microbiol Biotechnol. 2004, 4: pp. 306–311.

4. Banat IM, Franzetti A, Gandolfi I et al. Microbial biosurfactants production, applications and future potential. Appl Microbiol Biotechnol. 4; 2010: 427–444.

5. Singh P, Cameotra S. Potential applications of microbial surfactants in biomedical sciences. Trends Biotechnol. 4; 2004;142–146.

6. Mireles JR, Toguchi A, Harshey RM. Salmonella enterica Serovar typhimuriums warming mutants with altered biofilm-forming abilities: surfactin inhibits biofilm formation. J Bacteriol. 4; 2001:5848–5854.

7. Rivardo F, Turner RJ, Allegrone G et al. Anti-adhesion activity of two biosurfactants produced by Bacillus spp. prevents biofilm formation of human bacterial pathogens. Appl Microbiol Biotechnol 4; 2009: 541–553.

8. Heerklotz H, Seelig J. Leakage and lysis of lipid membranes induced by the lipopeptide surfactin. Eur Biophys J. 4; 2006: 4: 305–314.

9. Lee JH, Nam SH, Seo WT et al. The production of surfactin during the fermentation of cheonggukjang by potential probiotic Bacillus subtilis CSY191 and the resultant growth suppression of MCF-7 human breast cancer cells. Food Chem.4; 2012: 1347–1354.

10. Gudiña EJ, Rocha V, Teixeira JA, Rodrigues LR. Antimicrobial and anti-adhesive properties of a biosurfactant isolated from Lactobacillus paracasei ssp. paracasei A20. Lett Appl Microbiol. 4; 2010 a: 419–424.

11. Gudiña EJ, Teixeira JA, Rodrigues LR. Isolation and functional characterization of a biosurfactant produced by Lactobacillus paracasei. Colloids Surf B. 4; 2010 (b): 298–304.

12. Rodrigues LR. In: Bacterial adhesion: biology, chemistry, and physics, series. Adv Exp Med Biol. 2011: 351–367.

13. Banat IM, Makkar RS, cameotra SS. Potential commercial applications of microbial surfactants. Applied Microbiology Biotechnology. 53; 2000:495-508.

14. Desai JD, Banat IM, Banat IM.Microbial production of surfactants and their commercial potential. Microbiology and Molecular Biology Review. 61; 1997: 47-64.

15. Kleckner V, Kosaric NN. Biosurfactants, Production, Properties, Applications. New York: Surfactant Science Series. 48; 1993: 373–389.

16. Seghal Kiran G, Anto Thomas T, Selvin J et al. Optimization and characterization of a new lipopeptide biosurfactant produced by marine Brevibacterium aureum MSA13 in solid state culture. Bioresource Technol. 101; 2010, 2389-2396.

17. Youssef NH, Duncan KE, Nagle DP et al. Comparisons and methods to detect for production of Biosurfactant production in diverse microorganisms. J Microbiological Methods. 56; 2004: 339- 347.

18. Sen R, Swaminathan T. Application of response-surface methodology to evaluate the optimum environmental conditions for the enhanced production of surfactin. Appl. Microbiol. Biotechnol. 47;1997: 358-36.

19. Aparnaa A, Srinikethan G, Smitha H. Production and characterization of biosurfactant produced by a novel Pseudomonas sp. 2B. Colloids Surface B. 95;2012:pp.23-29.

20. Mosmann T. Rapid colorimetric assay for cellular growth and survival”, Application to proliferation and cytotoxicity assays. J. Immunol. Methods. 65; 1983: 55-63.

21. Prakash Sukhramani S, Poonam Sukhramani S, Sonal Tirthani R et al. Biological cytotoxicity evaluation of spiro[azetidine-2, 3’-indole]-2’, 4(1’H)-dione derivatives for anti-lung and anti-breast cancer activity. Der Pharmacia Lettre. 3(5);2011: 236-243.

22. Maciel BM, Santos ACF, Dias JCT et al. Simple DNA extraction protocol for a 16S rDNA study of bacterial diversity in tropical land farm soil used for bioremediation of oil waste. Genet Mol Res. 8(1); 2009: 375-388.

23. Ibrahim A, Arif, Haseeb A, Khan, et al. Comparison of neighbor-joining and maximum-parsimony methods for molecular phylogeny of Oryx species using 12S rRNA and 16S rRNA gene sequences. Anim Biol J. 1(2); 2009: 1-9.

24. Mariathason Birdilla Selva Donio, Fernando Arul Ronica, Vijayaragavan Thanga Viji. Thavasimuthu Citarasu alomonas sp. BS4 et.al “A biosurfactant producing halophilic bacterium isolated from solar salt works in India and their biomedical importance” Springerplus. 2; 2013:149.

25. Mueller JG , Chapman PJ, Blattmann BO, Pritchard PH. Isolation and characterization of a fluoranthene-utilizing strain of Pseudomonas paucimobilis. Appl Environ Microbiol. 56(4);1990: 1079-86.

26. Rodrigues LR, Banat IM, Teixeira JA, Oliveira R.Biosurfactants: potential applications in medicine. J Antimicrobiology Chemotheraphy. 57(4); 2006ª: 609–618.

27. Youssef N, Duncan K, Nagle D. et al. Comparison of methods to detect biosurfactant production by diverse microorganisms. J Microbiol Methods. 56(3); 2004: 339–347.

28. Joshi S, Bharucha C, Desai AJ. Biosurfactant production using molasses and whey under thermophilic conditions. Bioresource Technology. 99; 2008: 4603–8.

29. Faria AF, Teodoro-Martinez DS, Barbosa GNO et al. Production and structurual characterization of surfactin (C14/Leu7) produced by Bacillus subtilis isolate LSFM-05 grown on raw glycerol from biodiesel industry. Process Biochemistry. 46; 2011: 1951–7.

30. Zhao X, Geltinger C, Kishikawa S, et al. Tretament of mouse melanoma cells with phorbol 12-myristate 13-acetate counteracts mannosylerythritol lipid-induced growth arrest and apoptosis” Cytotechnology. 33(1-3);2000: 123-130.